ID: 938685453

View in Genome Browser
Species Human (GRCh38)
Location 2:133733405-133733427
Sequence TAACTGATACCCTGGCTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938685445_938685453 18 Left 938685445 2:133733364-133733386 CCAGTGGCCAGGTTTCTGTAACC No data
Right 938685453 2:133733405-133733427 TAACTGATACCCTGGCTAGGAGG No data
938685449_938685453 -4 Left 938685449 2:133733386-133733408 CCTCAGCAGGAAGCCATCATAAC No data
Right 938685453 2:133733405-133733427 TAACTGATACCCTGGCTAGGAGG No data
938685446_938685453 11 Left 938685446 2:133733371-133733393 CCAGGTTTCTGTAACCCTCAGCA No data
Right 938685453 2:133733405-133733427 TAACTGATACCCTGGCTAGGAGG No data
938685448_938685453 -3 Left 938685448 2:133733385-133733407 CCCTCAGCAGGAAGCCATCATAA No data
Right 938685453 2:133733405-133733427 TAACTGATACCCTGGCTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938685453 Original CRISPR TAACTGATACCCTGGCTAGG AGG Intergenic