ID: 938685454

View in Genome Browser
Species Human (GRCh38)
Location 2:133733406-133733428
Sequence AACTGATACCCTGGCTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938685448_938685454 -2 Left 938685448 2:133733385-133733407 CCCTCAGCAGGAAGCCATCATAA No data
Right 938685454 2:133733406-133733428 AACTGATACCCTGGCTAGGAGGG No data
938685449_938685454 -3 Left 938685449 2:133733386-133733408 CCTCAGCAGGAAGCCATCATAAC No data
Right 938685454 2:133733406-133733428 AACTGATACCCTGGCTAGGAGGG No data
938685446_938685454 12 Left 938685446 2:133733371-133733393 CCAGGTTTCTGTAACCCTCAGCA No data
Right 938685454 2:133733406-133733428 AACTGATACCCTGGCTAGGAGGG No data
938685445_938685454 19 Left 938685445 2:133733364-133733386 CCAGTGGCCAGGTTTCTGTAACC No data
Right 938685454 2:133733406-133733428 AACTGATACCCTGGCTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938685454 Original CRISPR AACTGATACCCTGGCTAGGA GGG Intergenic