ID: 938687598

View in Genome Browser
Species Human (GRCh38)
Location 2:133755554-133755576
Sequence GGCTGTTAAACCTTTCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938687598_938687600 -6 Left 938687598 2:133755554-133755576 CCCTGCTGAAAGGTTTAACAGCC No data
Right 938687600 2:133755571-133755593 ACAGCCATTCATATTTATAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938687598 Original CRISPR GGCTGTTAAACCTTTCAGCA GGG (reversed) Intergenic
No off target data available for this crispr