ID: 938692759

View in Genome Browser
Species Human (GRCh38)
Location 2:133807543-133807565
Sequence GTTTTCTGCTGTGCTGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938692759_938692763 -5 Left 938692759 2:133807543-133807565 CCAGCTGCAGCACAGCAGAAAAC No data
Right 938692763 2:133807561-133807583 AAAACCTCAGGCTGACTGAGGGG No data
938692759_938692766 0 Left 938692759 2:133807543-133807565 CCAGCTGCAGCACAGCAGAAAAC No data
Right 938692766 2:133807566-133807588 CTCAGGCTGACTGAGGGGATGGG No data
938692759_938692765 -1 Left 938692759 2:133807543-133807565 CCAGCTGCAGCACAGCAGAAAAC No data
Right 938692765 2:133807565-133807587 CCTCAGGCTGACTGAGGGGATGG No data
938692759_938692770 25 Left 938692759 2:133807543-133807565 CCAGCTGCAGCACAGCAGAAAAC No data
Right 938692770 2:133807591-133807613 GGTACCAGGCCAAAGCCACCTGG No data
938692759_938692762 -6 Left 938692759 2:133807543-133807565 CCAGCTGCAGCACAGCAGAAAAC No data
Right 938692762 2:133807560-133807582 GAAAACCTCAGGCTGACTGAGGG No data
938692759_938692769 11 Left 938692759 2:133807543-133807565 CCAGCTGCAGCACAGCAGAAAAC No data
Right 938692769 2:133807577-133807599 TGAGGGGATGGGGAGGTACCAGG No data
938692759_938692767 1 Left 938692759 2:133807543-133807565 CCAGCTGCAGCACAGCAGAAAAC No data
Right 938692767 2:133807567-133807589 TCAGGCTGACTGAGGGGATGGGG No data
938692759_938692761 -7 Left 938692759 2:133807543-133807565 CCAGCTGCAGCACAGCAGAAAAC No data
Right 938692761 2:133807559-133807581 AGAAAACCTCAGGCTGACTGAGG No data
938692759_938692768 4 Left 938692759 2:133807543-133807565 CCAGCTGCAGCACAGCAGAAAAC No data
Right 938692768 2:133807570-133807592 GGCTGACTGAGGGGATGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938692759 Original CRISPR GTTTTCTGCTGTGCTGCAGC TGG (reversed) Intergenic
No off target data available for this crispr