ID: 938694881

View in Genome Browser
Species Human (GRCh38)
Location 2:133826187-133826209
Sequence GGGCCCTGCACACTATGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938694881_938694892 12 Left 938694881 2:133826187-133826209 CCCTGGCATAGTGTGCAGGGCCC No data
Right 938694892 2:133826222-133826244 TTTGCCCCAGTGAGGGGACTTGG No data
938694881_938694893 15 Left 938694881 2:133826187-133826209 CCCTGGCATAGTGTGCAGGGCCC No data
Right 938694893 2:133826225-133826247 GCCCCAGTGAGGGGACTTGGAGG No data
938694881_938694889 5 Left 938694881 2:133826187-133826209 CCCTGGCATAGTGTGCAGGGCCC No data
Right 938694889 2:133826215-133826237 GTTGCCATTTGCCCCAGTGAGGG No data
938694881_938694890 6 Left 938694881 2:133826187-133826209 CCCTGGCATAGTGTGCAGGGCCC No data
Right 938694890 2:133826216-133826238 TTGCCATTTGCCCCAGTGAGGGG No data
938694881_938694888 4 Left 938694881 2:133826187-133826209 CCCTGGCATAGTGTGCAGGGCCC No data
Right 938694888 2:133826214-133826236 GGTTGCCATTTGCCCCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938694881 Original CRISPR GGGCCCTGCACACTATGCCA GGG (reversed) Intergenic
No off target data available for this crispr