ID: 938695650

View in Genome Browser
Species Human (GRCh38)
Location 2:133833122-133833144
Sequence GTCTCATTCATTGTCCTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938695650_938695653 12 Left 938695650 2:133833122-133833144 CCAGTAAGGACAATGAATGAGAC No data
Right 938695653 2:133833157-133833179 ACAGAGTGCCTGCCATGTGCAGG No data
938695650_938695656 23 Left 938695650 2:133833122-133833144 CCAGTAAGGACAATGAATGAGAC No data
Right 938695656 2:133833168-133833190 GCCATGTGCAGGGTAGCCAGTGG No data
938695650_938695654 13 Left 938695650 2:133833122-133833144 CCAGTAAGGACAATGAATGAGAC No data
Right 938695654 2:133833158-133833180 CAGAGTGCCTGCCATGTGCAGGG No data
938695650_938695658 24 Left 938695650 2:133833122-133833144 CCAGTAAGGACAATGAATGAGAC No data
Right 938695658 2:133833169-133833191 CCATGTGCAGGGTAGCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938695650 Original CRISPR GTCTCATTCATTGTCCTTAC TGG (reversed) Intergenic
No off target data available for this crispr