ID: 938702053

View in Genome Browser
Species Human (GRCh38)
Location 2:133888288-133888310
Sequence GTGGGGGGAAGGAGGTGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938702043_938702053 27 Left 938702043 2:133888238-133888260 CCTACGAAGGGAGGAGAGAATTC No data
Right 938702053 2:133888288-133888310 GTGGGGGGAAGGAGGTGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938702053 Original CRISPR GTGGGGGGAAGGAGGTGAGG CGG Intergenic
No off target data available for this crispr