ID: 938702092

View in Genome Browser
Species Human (GRCh38)
Location 2:133888552-133888574
Sequence TGAAGTGCATGGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938702086_938702092 5 Left 938702086 2:133888524-133888546 CCTGACAGGAGAAGCAACAAAGG No data
Right 938702092 2:133888552-133888574 TGAAGTGCATGGAGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938702092 Original CRISPR TGAAGTGCATGGAGGGCAGA GGG Intergenic
No off target data available for this crispr