ID: 938705767

View in Genome Browser
Species Human (GRCh38)
Location 2:133924189-133924211
Sequence ATGGCTTTCAAGAAGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938705764_938705767 -4 Left 938705764 2:133924170-133924192 CCACAGTGATGCAATGATGATGG No data
Right 938705767 2:133924189-133924211 ATGGCTTTCAAGAAGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938705767 Original CRISPR ATGGCTTTCAAGAAGGATGA AGG Intergenic
No off target data available for this crispr