ID: 938711614

View in Genome Browser
Species Human (GRCh38)
Location 2:133980158-133980180
Sequence AAAGCCCAGAAGGGTAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938711610_938711614 1 Left 938711610 2:133980134-133980156 CCCTGATGGTGAGATGAAGAAGC No data
Right 938711614 2:133980158-133980180 AAAGCCCAGAAGGGTAAAGTAGG No data
938711611_938711614 0 Left 938711611 2:133980135-133980157 CCTGATGGTGAGATGAAGAAGCA No data
Right 938711614 2:133980158-133980180 AAAGCCCAGAAGGGTAAAGTAGG No data
938711607_938711614 24 Left 938711607 2:133980111-133980133 CCCTCTTGAGCAGGTGTTGCTGT No data
Right 938711614 2:133980158-133980180 AAAGCCCAGAAGGGTAAAGTAGG No data
938711608_938711614 23 Left 938711608 2:133980112-133980134 CCTCTTGAGCAGGTGTTGCTGTC No data
Right 938711614 2:133980158-133980180 AAAGCCCAGAAGGGTAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938711614 Original CRISPR AAAGCCCAGAAGGGTAAAGT AGG Intergenic
No off target data available for this crispr