ID: 938712449

View in Genome Browser
Species Human (GRCh38)
Location 2:133987196-133987218
Sequence TTTTCTGTAAAGGTAGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938712449_938712452 3 Left 938712449 2:133987196-133987218 CCTACCTCTACCTTTACAGAAAA No data
Right 938712452 2:133987222-133987244 CACAATCTCTGCTTGTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938712449 Original CRISPR TTTTCTGTAAAGGTAGAGGT AGG (reversed) Intergenic
No off target data available for this crispr