ID: 938712533

View in Genome Browser
Species Human (GRCh38)
Location 2:133988049-133988071
Sequence AATCCCTGCCTCATAAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938712533_938712534 3 Left 938712533 2:133988049-133988071 CCATTCTTTATGAGGCAGGGATT No data
Right 938712534 2:133988075-133988097 GAGTATTTCTAAAAATTCACAGG No data
938712533_938712536 22 Left 938712533 2:133988049-133988071 CCATTCTTTATGAGGCAGGGATT No data
Right 938712536 2:133988094-133988116 CAGGGAGTAGCTGTCACCTCTGG No data
938712533_938712535 4 Left 938712533 2:133988049-133988071 CCATTCTTTATGAGGCAGGGATT No data
Right 938712535 2:133988076-133988098 AGTATTTCTAAAAATTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938712533 Original CRISPR AATCCCTGCCTCATAAAGAA TGG (reversed) Intergenic