ID: 938715104

View in Genome Browser
Species Human (GRCh38)
Location 2:134012189-134012211
Sequence ATGGGAGCGGATTCTCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938715104_938715113 23 Left 938715104 2:134012189-134012211 CCCCCAAGAGAATCCGCTCCCAT No data
Right 938715113 2:134012235-134012257 TACTTGCTAGAGACTTAACATGG No data
938715104_938715114 29 Left 938715104 2:134012189-134012211 CCCCCAAGAGAATCCGCTCCCAT No data
Right 938715114 2:134012241-134012263 CTAGAGACTTAACATGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938715104 Original CRISPR ATGGGAGCGGATTCTCTTGG GGG (reversed) Intergenic