ID: 938716151

View in Genome Browser
Species Human (GRCh38)
Location 2:134023683-134023705
Sequence GAGATAATACATCTAGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938716151_938716153 5 Left 938716151 2:134023683-134023705 CCCTGTTCTAGATGTATTATCTC No data
Right 938716153 2:134023711-134023733 ACCCTCACAGCAACCCTAAGAGG No data
938716151_938716156 14 Left 938716151 2:134023683-134023705 CCCTGTTCTAGATGTATTATCTC No data
Right 938716156 2:134023720-134023742 GCAACCCTAAGAGGTAAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938716151 Original CRISPR GAGATAATACATCTAGAACA GGG (reversed) Intergenic
No off target data available for this crispr