ID: 938716448

View in Genome Browser
Species Human (GRCh38)
Location 2:134026747-134026769
Sequence CTCCTATGCCTGGCAAATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938716442_938716448 11 Left 938716442 2:134026713-134026735 CCCTCCAGCACCATAGTTAAAGC No data
Right 938716448 2:134026747-134026769 CTCCTATGCCTGGCAAATACTGG No data
938716441_938716448 22 Left 938716441 2:134026702-134026724 CCAGTCATGCTCCCTCCAGCACC No data
Right 938716448 2:134026747-134026769 CTCCTATGCCTGGCAAATACTGG No data
938716445_938716448 1 Left 938716445 2:134026723-134026745 CCATAGTTAAAGCCACTACAGAG No data
Right 938716448 2:134026747-134026769 CTCCTATGCCTGGCAAATACTGG No data
938716443_938716448 10 Left 938716443 2:134026714-134026736 CCTCCAGCACCATAGTTAAAGCC No data
Right 938716448 2:134026747-134026769 CTCCTATGCCTGGCAAATACTGG No data
938716444_938716448 7 Left 938716444 2:134026717-134026739 CCAGCACCATAGTTAAAGCCACT No data
Right 938716448 2:134026747-134026769 CTCCTATGCCTGGCAAATACTGG No data
938716440_938716448 23 Left 938716440 2:134026701-134026723 CCCAGTCATGCTCCCTCCAGCAC No data
Right 938716448 2:134026747-134026769 CTCCTATGCCTGGCAAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938716448 Original CRISPR CTCCTATGCCTGGCAAATAC TGG Intergenic
No off target data available for this crispr