ID: 938718545

View in Genome Browser
Species Human (GRCh38)
Location 2:134043608-134043630
Sequence CTGCTGATACTGAGGCAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938718541_938718545 4 Left 938718541 2:134043581-134043603 CCAAAATCTGCTGTTCTGCAGCC No data
Right 938718545 2:134043608-134043630 CTGCTGATACTGAGGCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938718545 Original CRISPR CTGCTGATACTGAGGCAAAA AGG Intergenic
No off target data available for this crispr