ID: 938721260

View in Genome Browser
Species Human (GRCh38)
Location 2:134069181-134069203
Sequence GTGTGGGACTGGTTGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938721260_938721271 22 Left 938721260 2:134069181-134069203 CCAATTTCCAACCAGTCCCACAC No data
Right 938721271 2:134069226-134069248 TCCAACCTTATAGGATTGGGTGG No data
938721260_938721267 13 Left 938721260 2:134069181-134069203 CCAATTTCCAACCAGTCCCACAC No data
Right 938721267 2:134069217-134069239 CCCTTTACTTCCAACCTTATAGG No data
938721260_938721269 18 Left 938721260 2:134069181-134069203 CCAATTTCCAACCAGTCCCACAC No data
Right 938721269 2:134069222-134069244 TACTTCCAACCTTATAGGATTGG No data
938721260_938721273 25 Left 938721260 2:134069181-134069203 CCAATTTCCAACCAGTCCCACAC No data
Right 938721273 2:134069229-134069251 AACCTTATAGGATTGGGTGGTGG No data
938721260_938721270 19 Left 938721260 2:134069181-134069203 CCAATTTCCAACCAGTCCCACAC No data
Right 938721270 2:134069223-134069245 ACTTCCAACCTTATAGGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938721260 Original CRISPR GTGTGGGACTGGTTGGAAAT TGG (reversed) Intergenic
No off target data available for this crispr