ID: 938722059

View in Genome Browser
Species Human (GRCh38)
Location 2:134076025-134076047
Sequence CAGACAGGAGACCCTGCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938722057_938722059 -1 Left 938722057 2:134076003-134076025 CCGACGAATGTTCAGCTCGTAGC No data
Right 938722059 2:134076025-134076047 CAGACAGGAGACCCTGCAGTAGG No data
938722055_938722059 15 Left 938722055 2:134075987-134076009 CCTCAGGCAGGTCATCCCGACGA No data
Right 938722059 2:134076025-134076047 CAGACAGGAGACCCTGCAGTAGG No data
938722056_938722059 0 Left 938722056 2:134076002-134076024 CCCGACGAATGTTCAGCTCGTAG No data
Right 938722059 2:134076025-134076047 CAGACAGGAGACCCTGCAGTAGG No data
938722054_938722059 16 Left 938722054 2:134075986-134076008 CCCTCAGGCAGGTCATCCCGACG No data
Right 938722059 2:134076025-134076047 CAGACAGGAGACCCTGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938722059 Original CRISPR CAGACAGGAGACCCTGCAGT AGG Intergenic
No off target data available for this crispr