ID: 938722823

View in Genome Browser
Species Human (GRCh38)
Location 2:134081432-134081454
Sequence CCAGATGCAGAGATGGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938722823_938722834 24 Left 938722823 2:134081432-134081454 CCCAGTTCCATCTCTGCATCTGG No data
Right 938722834 2:134081479-134081501 TGGCCTGGTGCTCTCCAAGAGGG No data
938722823_938722833 23 Left 938722823 2:134081432-134081454 CCCAGTTCCATCTCTGCATCTGG No data
Right 938722833 2:134081478-134081500 GTGGCCTGGTGCTCTCCAAGAGG No data
938722823_938722832 9 Left 938722823 2:134081432-134081454 CCCAGTTCCATCTCTGCATCTGG No data
Right 938722832 2:134081464-134081486 GGGAGTCAGAGCGTGTGGCCTGG No data
938722823_938722831 4 Left 938722823 2:134081432-134081454 CCCAGTTCCATCTCTGCATCTGG No data
Right 938722831 2:134081459-134081481 AGAGAGGGAGTCAGAGCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938722823 Original CRISPR CCAGATGCAGAGATGGAACT GGG (reversed) Intergenic
No off target data available for this crispr