ID: 938726905

View in Genome Browser
Species Human (GRCh38)
Location 2:134116942-134116964
Sequence ACATTATGGCATCAGCCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938726900_938726905 18 Left 938726900 2:134116901-134116923 CCTGGATCACTATCTGCCAGGCA No data
Right 938726905 2:134116942-134116964 ACATTATGGCATCAGCCACTGGG No data
938726901_938726905 2 Left 938726901 2:134116917-134116939 CCAGGCATCACAGCTTACATCAT No data
Right 938726905 2:134116942-134116964 ACATTATGGCATCAGCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938726905 Original CRISPR ACATTATGGCATCAGCCACT GGG Intergenic
No off target data available for this crispr