ID: 938729918

View in Genome Browser
Species Human (GRCh38)
Location 2:134139299-134139321
Sequence GTGGCTGTTAAGATCCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938729915_938729918 1 Left 938729915 2:134139275-134139297 CCAGGGCAAACATCTTCATAGCC No data
Right 938729918 2:134139299-134139321 GTGGCTGTTAAGATCCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938729918 Original CRISPR GTGGCTGTTAAGATCCAGAA TGG Intronic
No off target data available for this crispr