ID: 938734038

View in Genome Browser
Species Human (GRCh38)
Location 2:134170043-134170065
Sequence CACCTAGTTGGTGCATCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938734038_938734040 20 Left 938734038 2:134170043-134170065 CCATATGATGCACCAACTAGGTG No data
Right 938734040 2:134170086-134170108 TAAAAGCACTGAAACTAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938734038 Original CRISPR CACCTAGTTGGTGCATCATA TGG (reversed) Intronic
No off target data available for this crispr