ID: 938736482

View in Genome Browser
Species Human (GRCh38)
Location 2:134191056-134191078
Sequence GGAGGGACACAGTTTCGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938736482_938736484 -9 Left 938736482 2:134191056-134191078 CCAAGCCGAAACTGTGTCCCTCC No data
Right 938736484 2:134191070-134191092 TGTCCCTCCCCGCCAGTCCCTGG No data
938736482_938736494 25 Left 938736482 2:134191056-134191078 CCAAGCCGAAACTGTGTCCCTCC No data
Right 938736494 2:134191104-134191126 CTTTTTCTGTATTATGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938736482 Original CRISPR GGAGGGACACAGTTTCGGCT TGG (reversed) Intronic
No off target data available for this crispr