ID: 938736494

View in Genome Browser
Species Human (GRCh38)
Location 2:134191104-134191126
Sequence CTTTTTCTGTATTATGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938736492_938736494 -7 Left 938736492 2:134191088-134191110 CCTGGCACCGTCTGTTCTTTTTC No data
Right 938736494 2:134191104-134191126 CTTTTTCTGTATTATGTGCCTGG No data
938736481_938736494 26 Left 938736481 2:134191055-134191077 CCCAAGCCGAAACTGTGTCCCTC No data
Right 938736494 2:134191104-134191126 CTTTTTCTGTATTATGTGCCTGG No data
938736485_938736494 8 Left 938736485 2:134191073-134191095 CCCTCCCCGCCAGTCCCTGGCAC No data
Right 938736494 2:134191104-134191126 CTTTTTCTGTATTATGTGCCTGG No data
938736489_938736494 2 Left 938736489 2:134191079-134191101 CCGCCAGTCCCTGGCACCGTCTG No data
Right 938736494 2:134191104-134191126 CTTTTTCTGTATTATGTGCCTGG No data
938736490_938736494 -1 Left 938736490 2:134191082-134191104 CCAGTCCCTGGCACCGTCTGTTC No data
Right 938736494 2:134191104-134191126 CTTTTTCTGTATTATGTGCCTGG No data
938736482_938736494 25 Left 938736482 2:134191056-134191078 CCAAGCCGAAACTGTGTCCCTCC No data
Right 938736494 2:134191104-134191126 CTTTTTCTGTATTATGTGCCTGG No data
938736491_938736494 -6 Left 938736491 2:134191087-134191109 CCCTGGCACCGTCTGTTCTTTTT No data
Right 938736494 2:134191104-134191126 CTTTTTCTGTATTATGTGCCTGG No data
938736483_938736494 20 Left 938736483 2:134191061-134191083 CCGAAACTGTGTCCCTCCCCGCC No data
Right 938736494 2:134191104-134191126 CTTTTTCTGTATTATGTGCCTGG No data
938736486_938736494 7 Left 938736486 2:134191074-134191096 CCTCCCCGCCAGTCCCTGGCACC No data
Right 938736494 2:134191104-134191126 CTTTTTCTGTATTATGTGCCTGG No data
938736488_938736494 3 Left 938736488 2:134191078-134191100 CCCGCCAGTCCCTGGCACCGTCT No data
Right 938736494 2:134191104-134191126 CTTTTTCTGTATTATGTGCCTGG No data
938736487_938736494 4 Left 938736487 2:134191077-134191099 CCCCGCCAGTCCCTGGCACCGTC No data
Right 938736494 2:134191104-134191126 CTTTTTCTGTATTATGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938736494 Original CRISPR CTTTTTCTGTATTATGTGCC TGG Intronic
No off target data available for this crispr