ID: 938736910

View in Genome Browser
Species Human (GRCh38)
Location 2:134193986-134194008
Sequence GATGGTATTGCACCTCCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938736907_938736910 -4 Left 938736907 2:134193967-134193989 CCGCTGGACACTGGTGCCAGATG No data
Right 938736910 2:134193986-134194008 GATGGTATTGCACCTCCTACTGG No data
938736904_938736910 13 Left 938736904 2:134193950-134193972 CCTGAGCGATATATCTTCCGCTG No data
Right 938736910 2:134193986-134194008 GATGGTATTGCACCTCCTACTGG No data
938736903_938736910 14 Left 938736903 2:134193949-134193971 CCCTGAGCGATATATCTTCCGCT No data
Right 938736910 2:134193986-134194008 GATGGTATTGCACCTCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938736910 Original CRISPR GATGGTATTGCACCTCCTAC TGG Intronic
No off target data available for this crispr