ID: 938739063

View in Genome Browser
Species Human (GRCh38)
Location 2:134213875-134213897
Sequence TCCATGAAGTCCCACATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938739063_938739066 -6 Left 938739063 2:134213875-134213897 CCTGTCATGTGGGACTTCATGGA No data
Right 938739066 2:134213892-134213914 CATGGAGGCCTCATTATGTAGGG No data
938739063_938739065 -7 Left 938739063 2:134213875-134213897 CCTGTCATGTGGGACTTCATGGA No data
Right 938739065 2:134213891-134213913 TCATGGAGGCCTCATTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938739063 Original CRISPR TCCATGAAGTCCCACATGAC AGG (reversed) Intronic
No off target data available for this crispr