ID: 938740685

View in Genome Browser
Species Human (GRCh38)
Location 2:134228842-134228864
Sequence CACAACTACAACTCACTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938740685_938740691 28 Left 938740685 2:134228842-134228864 CCATCTAGTGAGTTGTAGTTGTG No data
Right 938740691 2:134228893-134228915 CCCCCACCTGGTTATTTTCATGG No data
938740685_938740689 16 Left 938740685 2:134228842-134228864 CCATCTAGTGAGTTGTAGTTGTG No data
Right 938740689 2:134228881-134228903 CAGGGTCTCAGTCCCCCACCTGG No data
938740685_938740687 -2 Left 938740685 2:134228842-134228864 CCATCTAGTGAGTTGTAGTTGTG No data
Right 938740687 2:134228863-134228885 TGTCTTCTCCAACAAAGTCAGGG No data
938740685_938740686 -3 Left 938740685 2:134228842-134228864 CCATCTAGTGAGTTGTAGTTGTG No data
Right 938740686 2:134228862-134228884 GTGTCTTCTCCAACAAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938740685 Original CRISPR CACAACTACAACTCACTAGA TGG (reversed) Intronic
No off target data available for this crispr