ID: 938742265

View in Genome Browser
Species Human (GRCh38)
Location 2:134244112-134244134
Sequence AGATTTGCTTCCACTCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938742265_938742266 4 Left 938742265 2:134244112-134244134 CCTTTGAGAGTGGAAGCAAATCT No data
Right 938742266 2:134244139-134244161 AGTATTTTCATTCAACATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938742265 Original CRISPR AGATTTGCTTCCACTCTCAA AGG (reversed) Intronic
No off target data available for this crispr