ID: 938743836

View in Genome Browser
Species Human (GRCh38)
Location 2:134258741-134258763
Sequence TGGCAGGTCGAGAGTTGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938743833_938743836 0 Left 938743833 2:134258718-134258740 CCTCTGAAAATGCTTCTTCTAAG No data
Right 938743836 2:134258741-134258763 TGGCAGGTCGAGAGTTGTAGTGG No data
938743832_938743836 1 Left 938743832 2:134258717-134258739 CCCTCTGAAAATGCTTCTTCTAA No data
Right 938743836 2:134258741-134258763 TGGCAGGTCGAGAGTTGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938743836 Original CRISPR TGGCAGGTCGAGAGTTGTAG TGG Intronic
No off target data available for this crispr