ID: 938743933

View in Genome Browser
Species Human (GRCh38)
Location 2:134259494-134259516
Sequence CAGGGTTAACAACGTGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938743933_938743940 -6 Left 938743933 2:134259494-134259516 CCATCCACACGTTGTTAACCCTG No data
Right 938743940 2:134259511-134259533 ACCCTGGCTTCTCTGGGCTGGGG No data
938743933_938743939 -7 Left 938743933 2:134259494-134259516 CCATCCACACGTTGTTAACCCTG No data
Right 938743939 2:134259510-134259532 AACCCTGGCTTCTCTGGGCTGGG No data
938743933_938743938 -8 Left 938743933 2:134259494-134259516 CCATCCACACGTTGTTAACCCTG No data
Right 938743938 2:134259509-134259531 TAACCCTGGCTTCTCTGGGCTGG No data
938743933_938743944 23 Left 938743933 2:134259494-134259516 CCATCCACACGTTGTTAACCCTG No data
Right 938743944 2:134259540-134259562 CCTAGAAAAGCTGCCAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938743933 Original CRISPR CAGGGTTAACAACGTGTGGA TGG (reversed) Intronic
No off target data available for this crispr