ID: 938744033

View in Genome Browser
Species Human (GRCh38)
Location 2:134260130-134260152
Sequence CAGTGGCATGGAAGGTGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938744029_938744033 5 Left 938744029 2:134260102-134260124 CCACTGTAGCTAGAACGAAGCAA No data
Right 938744033 2:134260130-134260152 CAGTGGCATGGAAGGTGTTGAGG No data
938744026_938744033 28 Left 938744026 2:134260079-134260101 CCTACTCCAGGGTAGAAGGGAGG No data
Right 938744033 2:134260130-134260152 CAGTGGCATGGAAGGTGTTGAGG No data
938744028_938744033 22 Left 938744028 2:134260085-134260107 CCAGGGTAGAAGGGAGGCCACTG No data
Right 938744033 2:134260130-134260152 CAGTGGCATGGAAGGTGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938744033 Original CRISPR CAGTGGCATGGAAGGTGTTG AGG Intronic
No off target data available for this crispr