ID: 938750064

View in Genome Browser
Species Human (GRCh38)
Location 2:134319986-134320008
Sequence CAGGAAGAACATCTACTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938750064_938750069 9 Left 938750064 2:134319986-134320008 CCCACCAGTAGATGTTCTTCCTG 0: 1
1: 0
2: 2
3: 11
4: 135
Right 938750069 2:134320018-134320040 AGCCTGCATAGGATCAAAGCAGG 0: 1
1: 0
2: 1
3: 8
4: 197
938750064_938750072 21 Left 938750064 2:134319986-134320008 CCCACCAGTAGATGTTCTTCCTG 0: 1
1: 0
2: 2
3: 11
4: 135
Right 938750072 2:134320030-134320052 ATCAAAGCAGGGCCAAGAGCAGG 0: 1
1: 0
2: 0
3: 17
4: 234
938750064_938750070 10 Left 938750064 2:134319986-134320008 CCCACCAGTAGATGTTCTTCCTG 0: 1
1: 0
2: 2
3: 11
4: 135
Right 938750070 2:134320019-134320041 GCCTGCATAGGATCAAAGCAGGG 0: 1
1: 0
2: 1
3: 6
4: 115
938750064_938750068 -2 Left 938750064 2:134319986-134320008 CCCACCAGTAGATGTTCTTCCTG 0: 1
1: 0
2: 2
3: 11
4: 135
Right 938750068 2:134320007-134320029 TGTGTACAAGCAGCCTGCATAGG 0: 1
1: 1
2: 2
3: 3
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938750064 Original CRISPR CAGGAAGAACATCTACTGGT GGG (reversed) Intronic
904111263 1:28128431-28128453 CAGGAAGAATAGCTAATGGAGGG - Intergenic
904555706 1:31362104-31362126 TAAGAATAACATCTACTGGCTGG - Intronic
904583449 1:31564841-31564863 CTGGAAGAAGATCTGCTGGCTGG + Intergenic
905243804 1:36598430-36598452 CAAAAAGAACATCTTCTGGCTGG + Intergenic
905267255 1:36763131-36763153 CAGGAAGAATAGCTAATGGATGG - Intergenic
909795775 1:79734147-79734169 CTGGAACAACATATACTGATTGG + Intergenic
910267053 1:85348911-85348933 CAGAAAGAACTTCTTCTGGGTGG - Intronic
910665819 1:89725051-89725073 CAGGAGGAACATTTAGGGGTTGG + Intronic
911735345 1:101330935-101330957 CAGGCAGACCATCTAGTAGTAGG + Intergenic
918595402 1:186287109-186287131 CTGGAATAACATCTAATGGCCGG - Intergenic
918958852 1:191244820-191244842 CAGGAAGAATAGCTAACGGTTGG - Intergenic
923001103 1:230007037-230007059 CAGGAAGACCATCTTCTTGGTGG - Intergenic
1063856429 10:10259302-10259324 CAGGAGGAGCATCCCCTGGTTGG + Intergenic
1068451953 10:57202142-57202164 AAGGAATAAGATCTACTGTTTGG - Intergenic
1070739829 10:78895505-78895527 CAGCAAGGACAGCTACAGGTTGG + Intergenic
1071493801 10:86154177-86154199 CAGGAAGGACATCTACCCTTGGG - Intronic
1071752242 10:88493109-88493131 CAGAAATAACATGTACTGGTAGG - Intronic
1072500021 10:96005588-96005610 CAGGAAGAAAATATACAGGAGGG - Intronic
1075607706 10:123826022-123826044 CAGTACAAACATCTACTGGATGG + Intronic
1078964700 11:16324974-16324996 AAGGAATAAGATCTACTGTTTGG + Intronic
1079315036 11:19400315-19400337 CAGGTAGAACCTCTGGTGGTGGG + Intronic
1079413849 11:20214267-20214289 CAGGAACAAAATATACTGGAAGG - Intergenic
1080540620 11:33260759-33260781 CAGGAATAACAACTTCTGGAAGG - Intronic
1080748927 11:35135097-35135119 CAGGAATCACATGAACTGGTGGG - Intergenic
1084310051 11:68311900-68311922 CAGGAAGAAGACGTGCTGGTAGG - Intergenic
1084915778 11:72428061-72428083 CAGGAAGAACTATAACTGGTGGG + Intronic
1086910269 11:92464128-92464150 CAAGAATAACACCTAATGGTTGG + Intronic
1089893199 11:121901704-121901726 CAGGAAGAATAGCTAATGGATGG + Intergenic
1091340840 11:134812251-134812273 CATAAAGAACATGTACTGGCCGG + Intergenic
1094201552 12:27800207-27800229 CAGGAAGAGAATTAACTGGTTGG - Exonic
1098645456 12:72895016-72895038 CATGAAGAACATAAACTGGTGGG - Intergenic
1099079193 12:78155139-78155161 CAGGAAGAATAGCTAATGGATGG - Intronic
1103140495 12:118543799-118543821 CAGGAAGAACACCGACTTGGGGG + Intergenic
1108218818 13:48212147-48212169 CAAAAATAACATTTACTGGTAGG - Intergenic
1108346480 13:49551516-49551538 CAGGGAGAACATCTACTTAAAGG + Intronic
1109898702 13:68732198-68732220 CAGGAAGAATAGCTAATGGATGG + Intergenic
1110373340 13:74764225-74764247 CAAGAAGAACATCTTCTGGTAGG + Intergenic
1114010122 14:18357647-18357669 TAGGAATTACAACTACTGGTTGG - Intergenic
1114301401 14:21382118-21382140 CACAAAGAACTTCTACAGGTGGG + Intronic
1117314222 14:54558103-54558125 CAGGAAGAAAATGTGCTGGCAGG - Intergenic
1117497254 14:56318022-56318044 CAGGATGAACAGTTCCTGGTGGG - Intergenic
1120575886 14:86180686-86180708 CAGGAAGGACATGAACTTGTGGG - Intergenic
1123793263 15:23745736-23745758 GAGGAATAACATCTAGTGTTCGG - Intergenic
1125262156 15:37838939-37838961 CAGGTAGAAGATCCACTGCTTGG + Intergenic
1127545209 15:59987571-59987593 CAGGAACATCTTCTCCTGGTTGG + Intergenic
1129682067 15:77663643-77663665 GAGGAAGGACCCCTACTGGTGGG - Intronic
1131935633 15:97501274-97501296 ATGGTAAAACATCTACTGGTGGG + Intergenic
1132397140 15:101482309-101482331 CAGGAGAAACATCAGCTGGTGGG + Intronic
1135202029 16:20445796-20445818 TAGGAATAACATTTATTGGTTGG - Intergenic
1135217075 16:20582070-20582092 TAGGAATAACATTTATTGGTTGG + Intergenic
1135281473 16:21157133-21157155 CAGAAAGAAGAGCTAATGGTGGG - Intronic
1140878064 16:79171698-79171720 AAGAAAGAACATCTGCTGATTGG - Intronic
1141105695 16:81231840-81231862 GGGGAAGAACATGTACTGATCGG + Intergenic
1153458616 18:5308844-5308866 CAGGAAAAACAGAAACTGGTTGG + Intergenic
1154527712 18:15310226-15310248 TAGGAATTACAACTACTGGTTGG + Intergenic
1155636376 18:27960370-27960392 CAGGAAGAACATCTTGTAGATGG + Intronic
1158395881 18:57078074-57078096 CAGGAACAACTTCTACAGGGTGG - Intergenic
1158881376 18:61782680-61782702 CAGGAATAACATCTGCTGTTAGG + Intergenic
1162833890 19:13303630-13303652 CAGGAAAAGCAACCACTGGTGGG + Intronic
1165857487 19:38888647-38888669 AAGGCACAACATCTACTTGTTGG + Intronic
925046375 2:775966-775988 CAGGGAGAACAACTACTGTGAGG - Intergenic
925232986 2:2252412-2252434 TAGGAAGAACAGCTTGTGGTGGG - Intronic
926224082 2:10955065-10955087 CAGGAAGCAGAGCTCCTGGTTGG - Intergenic
927927781 2:27025429-27025451 CAGGAAGGGCATCTACAGCTAGG - Intronic
928433573 2:31239503-31239525 CAGGCAAAACATTTACTGGGAGG + Intronic
931919177 2:66994306-66994328 CAGGAGGAAAATCTCCTGGGAGG - Intergenic
932837935 2:75054766-75054788 TAGGAAGAACAGCTAATGTTTGG + Intronic
934051587 2:88215634-88215656 CAGGAAGACCATGCACTGGGCGG + Intergenic
938390848 2:130904167-130904189 CAGGAATAACACTTGCTGGTGGG - Intronic
938526808 2:132141683-132141705 TAGGAATTACAACTACTGGTTGG + Intergenic
938750064 2:134319986-134320008 CAGGAAGAACATCTACTGGTGGG - Intronic
939932682 2:148254606-148254628 CAGGTACAACGTCTGCTGGTAGG + Intronic
940969609 2:159881438-159881460 CAGGTAGAACATCTGCAGGCTGG + Intronic
942529161 2:176889716-176889738 CAGGAAGAGCATCAGCTGGCAGG + Intergenic
946549337 2:220783318-220783340 AAGGAAGGAAATGTACTGGTGGG + Intergenic
948883818 2:240873275-240873297 CAGGAGGGACAGCTTCTGGTGGG + Intronic
1168849697 20:968050-968072 CAGGAAGAGCCTCTGCTGGCAGG + Exonic
1170486496 20:16821654-16821676 CAGGAACGCCATCTACTGGCTGG + Intergenic
1174649745 20:52114592-52114614 CACTCAGAACATCTACTGTTAGG + Intronic
1175524282 20:59622818-59622840 CAGGATGTGCATCTCCTGGTGGG - Intronic
1176637615 21:9263179-9263201 AAGGAAGTCCACCTACTGGTGGG + Intergenic
1179933623 21:44589656-44589678 CAGGGAGGACATCTCCTGGTGGG - Intronic
1180434620 22:15288456-15288478 TAGGAATTACAACTACTGGTTGG - Intergenic
1180516829 22:16152262-16152284 TAGGAATTACAACTACTGGTTGG - Intergenic
1182125380 22:27811851-27811873 CAGGAAGAACCCCTGCTGGTTGG - Intergenic
1182424333 22:30264182-30264204 CAGGAACAACATCTACTGCATGG - Exonic
1182432512 22:30308373-30308395 CAGGATGAAGATCTTCAGGTTGG - Intronic
952859430 3:37800667-37800689 AGGGAAGAACATTTACTGGTAGG - Intronic
953137377 3:40193008-40193030 CAGGAAAAACAAAAACTGGTTGG - Intronic
954660493 3:52224417-52224439 CAGGAAGAACTTCTGCAGGTAGG - Intronic
954895417 3:53971003-53971025 AAGGAAGAACAGGTACTGGAAGG - Intergenic
956175251 3:66466997-66467019 CTGAAAGAACATCTATTGCTGGG - Intronic
959239395 3:103769137-103769159 CAGTAAGAACACCTATTTGTTGG + Intergenic
960285248 3:115820942-115820964 CAGGTAGAACATTTTCTGGAGGG + Intronic
961480280 3:127175037-127175059 CAGGAAGAAGGTCTGCAGGTAGG + Intergenic
961738286 3:129015783-129015805 CAGGAAGAACAGCTTGGGGTAGG - Intronic
964712492 3:159685947-159685969 CAGAAACAACTTCTAGTGGTTGG - Intronic
967450729 3:189619764-189619786 CTGGAAAAACATCTATTGGAGGG - Intergenic
967821433 3:193842711-193842733 CAGGAAGAGCACACACTGGTGGG + Intergenic
1202749280 3_GL000221v1_random:141842-141864 AAGGAAGTCCACCTACTGGTGGG - Intergenic
969979588 4:11140996-11141018 CAGGAAGACAAGCCACTGGTTGG + Intergenic
973255538 4:48108296-48108318 CAGGAAAAACATTTACAGTTTGG - Intronic
978115459 4:105015047-105015069 AAGGAAGAACAGTTACTGGAGGG + Intergenic
978128693 4:105167688-105167710 CAGGATGAACTGCTACTGCTAGG - Intronic
985855595 5:2422534-2422556 AAGGAAGAAAAACTACTGATTGG - Intergenic
994205055 5:97025190-97025212 CAGGAAGAACAGGCAGTGGTGGG + Intronic
995132127 5:108641909-108641931 GAGGAAGAAGATCCAGTGGTGGG - Intergenic
995287676 5:110410090-110410112 CATGAAGAACAGAGACTGGTGGG + Intronic
996663698 5:126033412-126033434 CAGGAAAAACATCTATTCCTGGG + Intergenic
999886713 5:155932282-155932304 CAGGAAGAAAGTCTACAGTTGGG - Intronic
1003708546 6:8562704-8562726 AAGGAATAACATCTAGTGTTTGG + Intergenic
1004304541 6:14487972-14487994 CAGGAAGACCAGCTACAGGGAGG + Intergenic
1004379076 6:15116603-15116625 CAGGAACAAATTCTACTGTTTGG - Intergenic
1005215827 6:23527084-23527106 GAGGAAGAAAATGTAGTGGTTGG + Intergenic
1006342725 6:33455427-33455449 CAGGAAGAGCATCCAGTGGCAGG - Exonic
1006375013 6:33667220-33667242 CAGGCGGAACATGTGCTGGTAGG - Exonic
1013192604 6:107816383-107816405 CAGGAAGAACATCTCCAGGGAGG + Intronic
1013270133 6:108537565-108537587 CAGGAAGAACATCTGTGAGTTGG + Intergenic
1015223100 6:130826964-130826986 GAGGAAGAATTTCTACTTGTGGG + Intergenic
1020250711 7:6466210-6466232 CAGGAAGAACAGGTAGTGGGTGG + Exonic
1024989994 7:55225871-55225893 CAGGAAGAACAGCTAGTGCATGG - Intronic
1030698169 7:112608681-112608703 CTTGAAAAACATCTAATGGTTGG - Intergenic
1032454346 7:132061312-132061334 CAGGAAAAATATATAATGGTAGG + Intergenic
1033515954 7:142106310-142106332 CAGAAAGAACATCTGCTAGTTGG + Exonic
1037896402 8:22659109-22659131 CCGGCAGAACAGCTGCTGGTTGG + Intronic
1038874702 8:31535338-31535360 CAGGAAGACACTTTACTGGTGGG + Intergenic
1041141086 8:54820207-54820229 CAGGAAGAAACTCCACTGCTTGG - Intergenic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1041566748 8:59287026-59287048 CAGAAAGAATCTCTAGTGGTAGG - Intergenic
1041710764 8:60892352-60892374 CAGGAAGAAAACATACTGTTTGG + Intergenic
1042702117 8:71626642-71626664 CAGGAAAAAAAAATACTGGTGGG + Intergenic
1044690588 8:94873511-94873533 CAGGAAGAACATATACAGGTAGG - Intronic
1049803937 8:144530473-144530495 CAGGAAGGACATCTCCTTGCGGG + Exonic
1050244484 9:3673524-3673546 TAGGAAACACATCTACTGGGAGG + Intergenic
1055973364 9:81932815-81932837 AAGGAAGGACATCTCCTGGGAGG - Intergenic
1055975118 9:81947907-81947929 AAGGAAGGACATCTCCTGGGAGG - Intergenic
1057082459 9:92183307-92183329 CAGCAGGAACATCTGCTGGAAGG - Intergenic
1057324075 9:94044419-94044441 CAGGAAGAACAGCTAATGCTGGG - Intronic
1059469544 9:114494256-114494278 CAGGAAGAGCAGCATCTGGTAGG + Intronic
1061371896 9:130202016-130202038 CAGGGAGAACATGTACGGATGGG - Intronic
1186735319 X:12457210-12457232 CTTGAAGAACATTTTCTGGTGGG + Intronic
1186932412 X:14409194-14409216 CAGGAATAAGATCTAATGTTCGG - Intergenic
1189059120 X:37733769-37733791 AAGGAAAAACATCTACAGATTGG - Intronic
1192717083 X:73655020-73655042 CAGAAAGAACAACTAATGGATGG - Intronic
1192948000 X:75986388-75986410 CAGGAAGAAAAGCTCTTGGTAGG + Intergenic
1193672832 X:84410502-84410524 CAGGAAGAAAACCTACTTGATGG + Intronic
1194331068 X:92583326-92583348 CAGGAAGATCATCTAAGGTTGGG - Intronic
1198211924 X:134524347-134524369 CAGGAAGAACAGCTAATGCGGGG - Intergenic
1200639767 Y:5702390-5702412 CAGGAAGATCATCTAAGGTTGGG - Intronic