ID: 938757316

View in Genome Browser
Species Human (GRCh38)
Location 2:134392834-134392856
Sequence TATGCTGTCCCACCCAGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938757311_938757316 8 Left 938757311 2:134392803-134392825 CCTTAGTGATGTGGCATAGTGGA No data
Right 938757316 2:134392834-134392856 TATGCTGTCCCACCCAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938757316 Original CRISPR TATGCTGTCCCACCCAGAAG GGG Intronic
No off target data available for this crispr