ID: 938761171

View in Genome Browser
Species Human (GRCh38)
Location 2:134427489-134427511
Sequence CGATTTTATTTGAGGGGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938761171_938761178 12 Left 938761171 2:134427489-134427511 CCTACTCCCCTCAAATAAAATCG No data
Right 938761178 2:134427524-134427546 TAGAAACCTCAAGGCTTTTTTGG No data
938761171_938761177 3 Left 938761171 2:134427489-134427511 CCTACTCCCCTCAAATAAAATCG No data
Right 938761177 2:134427515-134427537 TCTTTAGCATAGAAACCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938761171 Original CRISPR CGATTTTATTTGAGGGGAGT AGG (reversed) Intronic
No off target data available for this crispr