ID: 938762855

View in Genome Browser
Species Human (GRCh38)
Location 2:134441409-134441431
Sequence CCATCAACACTTATGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938762855_938762857 6 Left 938762855 2:134441409-134441431 CCTGGCTGCATAAGTGTTGATGG No data
Right 938762857 2:134441438-134441460 TTGAGAATAGCCACCCTTCACGG No data
938762855_938762861 16 Left 938762855 2:134441409-134441431 CCTGGCTGCATAAGTGTTGATGG No data
Right 938762861 2:134441448-134441470 CCACCCTTCACGGGCAGGCGTGG No data
938762855_938762859 11 Left 938762855 2:134441409-134441431 CCTGGCTGCATAAGTGTTGATGG No data
Right 938762859 2:134441443-134441465 AATAGCCACCCTTCACGGGCAGG No data
938762855_938762858 7 Left 938762855 2:134441409-134441431 CCTGGCTGCATAAGTGTTGATGG No data
Right 938762858 2:134441439-134441461 TGAGAATAGCCACCCTTCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938762855 Original CRISPR CCATCAACACTTATGCAGCC AGG (reversed) Intronic
No off target data available for this crispr