ID: 938766364

View in Genome Browser
Species Human (GRCh38)
Location 2:134462837-134462859
Sequence CCCATGGTCATGGGCAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938766347_938766364 21 Left 938766347 2:134462793-134462815 CCAACCAAGTCACAGGGCCAGTG No data
Right 938766364 2:134462837-134462859 CCCATGGTCATGGGCAGGGTGGG No data
938766348_938766364 17 Left 938766348 2:134462797-134462819 CCAAGTCACAGGGCCAGTGTTCC No data
Right 938766364 2:134462837-134462859 CCCATGGTCATGGGCAGGGTGGG No data
938766355_938766364 4 Left 938766355 2:134462810-134462832 CCAGTGTTCCAAGGAGGGGGGTC No data
Right 938766364 2:134462837-134462859 CCCATGGTCATGGGCAGGGTGGG No data
938766356_938766364 -4 Left 938766356 2:134462818-134462840 CCAAGGAGGGGGGTCAAGTCCCA No data
Right 938766364 2:134462837-134462859 CCCATGGTCATGGGCAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938766364 Original CRISPR CCCATGGTCATGGGCAGGGT GGG Intronic
No off target data available for this crispr