ID: 938770834

View in Genome Browser
Species Human (GRCh38)
Location 2:134499453-134499475
Sequence TCCAGGGCTGTGTGGGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938770834_938770845 22 Left 938770834 2:134499453-134499475 CCATTTGCCCACACAGCCCTGGA No data
Right 938770845 2:134499498-134499520 CAGTTCCCCAGAGAGCCAGCTGG No data
938770834_938770837 -9 Left 938770834 2:134499453-134499475 CCATTTGCCCACACAGCCCTGGA No data
Right 938770837 2:134499467-134499489 AGCCCTGGAGCAGAGTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938770834 Original CRISPR TCCAGGGCTGTGTGGGCAAA TGG (reversed) Intronic
No off target data available for this crispr