ID: 938779862 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:134575338-134575360 |
| Sequence | CAGCAGGAATGGTGGGCACT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 938779862_938779868 | -4 | Left | 938779862 | 2:134575338-134575360 | CCCAGTGCCCACCATTCCTGCTG | No data | ||
| Right | 938779868 | 2:134575357-134575379 | GCTGCTGTCAGCCAAGAGCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 938779862 | Original CRISPR | CAGCAGGAATGGTGGGCACT GGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||