ID: 938779862

View in Genome Browser
Species Human (GRCh38)
Location 2:134575338-134575360
Sequence CAGCAGGAATGGTGGGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938779862_938779868 -4 Left 938779862 2:134575338-134575360 CCCAGTGCCCACCATTCCTGCTG No data
Right 938779868 2:134575357-134575379 GCTGCTGTCAGCCAAGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938779862 Original CRISPR CAGCAGGAATGGTGGGCACT GGG (reversed) Intronic
No off target data available for this crispr