ID: 938784131

View in Genome Browser
Species Human (GRCh38)
Location 2:134609947-134609969
Sequence TACGAGGCCTACAGGGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938784116_938784131 28 Left 938784116 2:134609896-134609918 CCCCGAGAACTGTGCTGGTGAAA No data
Right 938784131 2:134609947-134609969 TACGAGGCCTACAGGGGAAGGGG No data
938784118_938784131 26 Left 938784118 2:134609898-134609920 CCGAGAACTGTGCTGGTGAAAAG No data
Right 938784131 2:134609947-134609969 TACGAGGCCTACAGGGGAAGGGG No data
938784117_938784131 27 Left 938784117 2:134609897-134609919 CCCGAGAACTGTGCTGGTGAAAA No data
Right 938784131 2:134609947-134609969 TACGAGGCCTACAGGGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938784131 Original CRISPR TACGAGGCCTACAGGGGAAG GGG Intronic
No off target data available for this crispr