ID: 938789907

View in Genome Browser
Species Human (GRCh38)
Location 2:134667363-134667385
Sequence AGGGATTCCCTTACAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938789900_938789907 29 Left 938789900 2:134667311-134667333 CCATGAGATGAAGTTCTAGCCAA No data
Right 938789907 2:134667363-134667385 AGGGATTCCCTTACAGAGAGAGG No data
938789903_938789907 10 Left 938789903 2:134667330-134667352 CCAATGGGATCTGAGTGCAAACT No data
Right 938789907 2:134667363-134667385 AGGGATTCCCTTACAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938789907 Original CRISPR AGGGATTCCCTTACAGAGAG AGG Intronic
No off target data available for this crispr