ID: 938794585 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:134706972-134706994 |
| Sequence | GAACAGGCAGACCAGCGGTT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 938794585_938794596 | 15 | Left | 938794585 | 2:134706972-134706994 | CCAAACCGCTGGTCTGCCTGTTC | No data | ||
| Right | 938794596 | 2:134707010-134707032 | CACCTCTCAGAAGCAGCCTCCGG | No data | ||||
| 938794585_938794597 | 16 | Left | 938794585 | 2:134706972-134706994 | CCAAACCGCTGGTCTGCCTGTTC | No data | ||
| Right | 938794597 | 2:134707011-134707033 | ACCTCTCAGAAGCAGCCTCCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 938794585 | Original CRISPR | GAACAGGCAGACCAGCGGTT TGG (reversed) | Intronic | ||