ID: 938794586

View in Genome Browser
Species Human (GRCh38)
Location 2:134706977-134706999
Sequence GGGAGGAACAGGCAGACCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938794586_938794596 10 Left 938794586 2:134706977-134706999 CCGCTGGTCTGCCTGTTCCTCCC No data
Right 938794596 2:134707010-134707032 CACCTCTCAGAAGCAGCCTCCGG No data
938794586_938794597 11 Left 938794586 2:134706977-134706999 CCGCTGGTCTGCCTGTTCCTCCC No data
Right 938794597 2:134707011-134707033 ACCTCTCAGAAGCAGCCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938794586 Original CRISPR GGGAGGAACAGGCAGACCAG CGG (reversed) Intronic