ID: 938794588

View in Genome Browser
Species Human (GRCh38)
Location 2:134706988-134707010
Sequence GGGGACCAGGAGGGAGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938794588_938794597 0 Left 938794588 2:134706988-134707010 CCTGTTCCTCCCTCCTGGTCCCC No data
Right 938794597 2:134707011-134707033 ACCTCTCAGAAGCAGCCTCCGGG No data
938794588_938794602 28 Left 938794588 2:134706988-134707010 CCTGTTCCTCCCTCCTGGTCCCC No data
Right 938794602 2:134707039-134707061 CGTTCCCAAGCACACCCACAGGG No data
938794588_938794596 -1 Left 938794588 2:134706988-134707010 CCTGTTCCTCCCTCCTGGTCCCC No data
Right 938794596 2:134707010-134707032 CACCTCTCAGAAGCAGCCTCCGG No data
938794588_938794601 27 Left 938794588 2:134706988-134707010 CCTGTTCCTCCCTCCTGGTCCCC No data
Right 938794601 2:134707038-134707060 TCGTTCCCAAGCACACCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938794588 Original CRISPR GGGGACCAGGAGGGAGGAAC AGG (reversed) Intronic
No off target data available for this crispr