ID: 938794590

View in Genome Browser
Species Human (GRCh38)
Location 2:134706997-134707019
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938794590_938794596 -10 Left 938794590 2:134706997-134707019 CCCTCCTGGTCCCCACCTCTCAG No data
Right 938794596 2:134707010-134707032 CACCTCTCAGAAGCAGCCTCCGG No data
938794590_938794602 19 Left 938794590 2:134706997-134707019 CCCTCCTGGTCCCCACCTCTCAG No data
Right 938794602 2:134707039-134707061 CGTTCCCAAGCACACCCACAGGG No data
938794590_938794597 -9 Left 938794590 2:134706997-134707019 CCCTCCTGGTCCCCACCTCTCAG No data
Right 938794597 2:134707011-134707033 ACCTCTCAGAAGCAGCCTCCGGG No data
938794590_938794601 18 Left 938794590 2:134706997-134707019 CCCTCCTGGTCCCCACCTCTCAG No data
Right 938794601 2:134707038-134707060 TCGTTCCCAAGCACACCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938794590 Original CRISPR CTGAGAGGTGGGGACCAGGA GGG (reversed) Intronic