ID: 938794591

View in Genome Browser
Species Human (GRCh38)
Location 2:134706998-134707020
Sequence TCTGAGAGGTGGGGACCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938794591_938794602 18 Left 938794591 2:134706998-134707020 CCTCCTGGTCCCCACCTCTCAGA No data
Right 938794602 2:134707039-134707061 CGTTCCCAAGCACACCCACAGGG No data
938794591_938794601 17 Left 938794591 2:134706998-134707020 CCTCCTGGTCCCCACCTCTCAGA No data
Right 938794601 2:134707038-134707060 TCGTTCCCAAGCACACCCACAGG No data
938794591_938794597 -10 Left 938794591 2:134706998-134707020 CCTCCTGGTCCCCACCTCTCAGA No data
Right 938794597 2:134707011-134707033 ACCTCTCAGAAGCAGCCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938794591 Original CRISPR TCTGAGAGGTGGGGACCAGG AGG (reversed) Intronic