ID: 938794592

View in Genome Browser
Species Human (GRCh38)
Location 2:134707001-134707023
Sequence GCTTCTGAGAGGTGGGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938794592_938794601 14 Left 938794592 2:134707001-134707023 CCTGGTCCCCACCTCTCAGAAGC No data
Right 938794601 2:134707038-134707060 TCGTTCCCAAGCACACCCACAGG No data
938794592_938794602 15 Left 938794592 2:134707001-134707023 CCTGGTCCCCACCTCTCAGAAGC No data
Right 938794602 2:134707039-134707061 CGTTCCCAAGCACACCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938794592 Original CRISPR GCTTCTGAGAGGTGGGGACC AGG (reversed) Intronic