ID: 938794593

View in Genome Browser
Species Human (GRCh38)
Location 2:134707007-134707029
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938794593_938794601 8 Left 938794593 2:134707007-134707029 CCCCACCTCTCAGAAGCAGCCTC No data
Right 938794601 2:134707038-134707060 TCGTTCCCAAGCACACCCACAGG No data
938794593_938794602 9 Left 938794593 2:134707007-134707029 CCCCACCTCTCAGAAGCAGCCTC No data
Right 938794602 2:134707039-134707061 CGTTCCCAAGCACACCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938794593 Original CRISPR GAGGCTGCTTCTGAGAGGTG GGG (reversed) Intronic