ID: 938794594

View in Genome Browser
Species Human (GRCh38)
Location 2:134707008-134707030
Sequence GGAGGCTGCTTCTGAGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938794594_938794602 8 Left 938794594 2:134707008-134707030 CCCACCTCTCAGAAGCAGCCTCC No data
Right 938794602 2:134707039-134707061 CGTTCCCAAGCACACCCACAGGG No data
938794594_938794601 7 Left 938794594 2:134707008-134707030 CCCACCTCTCAGAAGCAGCCTCC No data
Right 938794601 2:134707038-134707060 TCGTTCCCAAGCACACCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938794594 Original CRISPR GGAGGCTGCTTCTGAGAGGT GGG (reversed) Intronic
No off target data available for this crispr