ID: 938794595

View in Genome Browser
Species Human (GRCh38)
Location 2:134707009-134707031
Sequence CGGAGGCTGCTTCTGAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938794595_938794601 6 Left 938794595 2:134707009-134707031 CCACCTCTCAGAAGCAGCCTCCG No data
Right 938794601 2:134707038-134707060 TCGTTCCCAAGCACACCCACAGG No data
938794595_938794602 7 Left 938794595 2:134707009-134707031 CCACCTCTCAGAAGCAGCCTCCG No data
Right 938794602 2:134707039-134707061 CGTTCCCAAGCACACCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938794595 Original CRISPR CGGAGGCTGCTTCTGAGAGG TGG (reversed) Intronic
No off target data available for this crispr