ID: 938794597

View in Genome Browser
Species Human (GRCh38)
Location 2:134707011-134707033
Sequence ACCTCTCAGAAGCAGCCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938794584_938794597 17 Left 938794584 2:134706971-134706993 CCCAAACCGCTGGTCTGCCTGTT No data
Right 938794597 2:134707011-134707033 ACCTCTCAGAAGCAGCCTCCGGG No data
938794590_938794597 -9 Left 938794590 2:134706997-134707019 CCCTCCTGGTCCCCACCTCTCAG No data
Right 938794597 2:134707011-134707033 ACCTCTCAGAAGCAGCCTCCGGG No data
938794586_938794597 11 Left 938794586 2:134706977-134706999 CCGCTGGTCTGCCTGTTCCTCCC No data
Right 938794597 2:134707011-134707033 ACCTCTCAGAAGCAGCCTCCGGG No data
938794589_938794597 -6 Left 938794589 2:134706994-134707016 CCTCCCTCCTGGTCCCCACCTCT No data
Right 938794597 2:134707011-134707033 ACCTCTCAGAAGCAGCCTCCGGG No data
938794591_938794597 -10 Left 938794591 2:134706998-134707020 CCTCCTGGTCCCCACCTCTCAGA No data
Right 938794597 2:134707011-134707033 ACCTCTCAGAAGCAGCCTCCGGG No data
938794588_938794597 0 Left 938794588 2:134706988-134707010 CCTGTTCCTCCCTCCTGGTCCCC No data
Right 938794597 2:134707011-134707033 ACCTCTCAGAAGCAGCCTCCGGG No data
938794585_938794597 16 Left 938794585 2:134706972-134706994 CCAAACCGCTGGTCTGCCTGTTC No data
Right 938794597 2:134707011-134707033 ACCTCTCAGAAGCAGCCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938794597 Original CRISPR ACCTCTCAGAAGCAGCCTCC GGG Intronic
No off target data available for this crispr